BLAST against gene transcripts

This form uses the BLAST program to translate a specified SNP onto a GenBank sequence and then determines whether or not it results in an amino acid substitution. For example, the sequence TGAAAGATAAGAAAGAACTAGAAGGT[G/T]CTGGGAAGGTGAGTCAAACTAAAT results in the change Ala892Ser in NM_000927. Click here to see a demo.

This is an experimental service; please report any problems to edmonson@nih.gov with as much detail as possible, including your query sequence and the complete URL.

SNP sequence:
Instructions...
Search:
Select:
-or-
Single sequence:
Filter low-complexity sequence?:

Questions, comments, and suggestions to: Michael Edmonson (edmonson@nih.gov) LPG, NCI
Last modified: Mon Dec 18 17:48:23 2006